ID: 930429133_930429135

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 930429133 930429135
Species Human (GRCh38) Human (GRCh38)
Location 2:51251542-51251564 2:51251556-51251578
Sequence CCCTGAAGACAAATACCACTGCC ACCACTGCCCACAACAACTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!