ID: 930442047_930442049

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 930442047 930442049
Species Human (GRCh38) Human (GRCh38)
Location 2:51421039-51421061 2:51421054-51421076
Sequence CCTGCTGGTGGCATGTGCCTGTG TGCCTGTGGTCCCAGTTACTTGG
Strand - +
Off-target summary No data {0: 97, 1: 4363, 2: 43794, 3: 143564, 4: 150011}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!