ID: 930442047_930442050

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 930442047 930442050
Species Human (GRCh38) Human (GRCh38)
Location 2:51421039-51421061 2:51421055-51421077
Sequence CCTGCTGGTGGCATGTGCCTGTG GCCTGTGGTCCCAGTTACTTGGG
Strand - +
Off-target summary No data {0: 93, 1: 4081, 2: 47274, 3: 180115, 4: 263071}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!