ID: 930442047_930442052

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 930442047 930442052
Species Human (GRCh38) Human (GRCh38)
Location 2:51421039-51421061 2:51421058-51421080
Sequence CCTGCTGGTGGCATGTGCCTGTG TGTGGTCCCAGTTACTTGGGTGG
Strand - +
Off-target summary No data {0: 169, 1: 6195, 2: 58018, 3: 174484, 4: 230179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!