ID: 930442047_930442054

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 930442047 930442054
Species Human (GRCh38) Human (GRCh38)
Location 2:51421039-51421061 2:51421064-51421086
Sequence CCTGCTGGTGGCATGTGCCTGTG CCCAGTTACTTGGGTGGCTGCGG
Strand - +
Off-target summary No data {0: 46, 1: 3735, 2: 100700, 3: 212554, 4: 252451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!