ID: 930527762_930527763

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 930527762 930527763
Species Human (GRCh38) Human (GRCh38)
Location 2:52551575-52551597 2:52551596-52551618
Sequence CCTCTAATGGTTGCAGAATACAC ACATTCTTTTCTTCAGCACATGG
Strand - +
Off-target summary No data {0: 18, 1: 271, 2: 900, 3: 1544, 4: 1894}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!