ID: 930606299_930606308

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 930606299 930606308
Species Human (GRCh38) Human (GRCh38)
Location 2:53496856-53496878 2:53496909-53496931
Sequence CCTGTGTGTTTCTGGCCTAATTG ATGCATAGACTGGCAGCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!