ID: 930606300_930606308

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 930606300 930606308
Species Human (GRCh38) Human (GRCh38)
Location 2:53496871-53496893 2:53496909-53496931
Sequence CCTAATTGCCGATTTCTCCTCAG ATGCATAGACTGGCAGCTTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!