ID: 930859910_930859917

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 930859910 930859917
Species Human (GRCh38) Human (GRCh38)
Location 2:56060894-56060916 2:56060937-56060959
Sequence CCGGTTTTCCCAAAGGAGTCCTT CAGATTTGTCAAAGATCAGATGG
Strand - +
Off-target summary No data {0: 312, 1: 6328, 2: 3935, 3: 2626, 4: 3018}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!