ID: 930987287_930987290

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 930987287 930987290
Species Human (GRCh38) Human (GRCh38)
Location 2:57605793-57605815 2:57605808-57605830
Sequence CCTTGCCAAAGTTGCTTATCAGC TTATCAGCTTAAGGAGTTTTTGG
Strand - +
Off-target summary No data {0: 558, 1: 10672, 2: 5569, 3: 2403, 4: 1397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!