ID: 931050378_931050379

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 931050378 931050379
Species Human (GRCh38) Human (GRCh38)
Location 2:58407286-58407308 2:58407303-58407325
Sequence CCGTCTCTACTAAAAATGCAAAA GCAAAATTAACCGAGCACAGCGG
Strand - +
Off-target summary {0: 4729, 1: 200398, 2: 140886, 3: 66420, 4: 54242} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!