ID: 931050380_931050381

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 931050380 931050381
Species Human (GRCh38) Human (GRCh38)
Location 2:58407313-58407335 2:58407331-58407353
Sequence CCGAGCACAGCGGCATGTGCCTG GCCTGTTATCCCAGCTACTCAGG
Strand - +
Off-target summary No data {0: 426, 1: 76200, 2: 213790, 3: 235229, 4: 174740}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!