ID: 931050380_931050385

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 931050380 931050385
Species Human (GRCh38) Human (GRCh38)
Location 2:58407313-58407335 2:58407340-58407362
Sequence CCGAGCACAGCGGCATGTGCCTG CCCAGCTACTCAGGAGGCTGAGG
Strand - +
Off-target summary No data {0: 92886, 1: 198857, 2: 236674, 3: 157910, 4: 88870}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!