ID: 931050380_931050387

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 931050380 931050387
Species Human (GRCh38) Human (GRCh38)
Location 2:58407313-58407335 2:58407344-58407366
Sequence CCGAGCACAGCGGCATGTGCCTG GCTACTCAGGAGGCTGAGGCAGG
Strand - +
Off-target summary No data {0: 77881, 1: 176222, 2: 210480, 3: 146546, 4: 90715}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!