ID: 931050382_931050389

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 931050382 931050389
Species Human (GRCh38) Human (GRCh38)
Location 2:58407332-58407354 2:58407363-58407385
Sequence CCTGTTATCCCAGCTACTCAGGA CAGGAGAATCGCTTGAACCTGGG
Strand - +
Off-target summary {0: 310, 1: 56158, 2: 148024, 3: 234292, 4: 204228} {0: 22579, 1: 106059, 2: 182600, 3: 191733, 4: 130765}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!