ID: 931050384_931050390

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 931050384 931050390
Species Human (GRCh38) Human (GRCh38)
Location 2:58407340-58407362 2:58407369-58407391
Sequence CCCAGCTACTCAGGAGGCTGAGG AATCGCTTGAACCTGGGAGATGG
Strand - +
Off-target summary No data {0: 1083, 1: 19432, 2: 63744, 3: 100956, 4: 122830}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!