ID: 931050386_931050388

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 931050386 931050388
Species Human (GRCh38) Human (GRCh38)
Location 2:58407341-58407363 2:58407362-58407384
Sequence CCAGCTACTCAGGAGGCTGAGGC GCAGGAGAATCGCTTGAACCTGG
Strand - +
Off-target summary {0: 84870, 1: 190808, 2: 228673, 3: 158767, 4: 94038} {0: 41236, 1: 112059, 2: 146946, 3: 86404, 4: 46144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!