ID: 931355837_931355846

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 931355837 931355846
Species Human (GRCh38) Human (GRCh38)
Location 2:61537472-61537494 2:61537493-61537515
Sequence CCGCCGCCGCCGCGCCCCACGCC CCGGCCTCCTCCCGCCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 35, 3: 271, 4: 3042} {0: 1, 1: 0, 2: 6, 3: 66, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!