ID: 931495739_931495741

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 931495739 931495741
Species Human (GRCh38) Human (GRCh38)
Location 2:62805011-62805033 2:62805027-62805049
Sequence CCAGAAAGATTGGGGACAGCTGT CAGCTGTTCTAGAGGACAAATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 31, 3: 299, 4: 1240} {0: 1, 1: 0, 2: 1, 3: 20, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!