ID: 931620042_931620045

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 931620042 931620045
Species Human (GRCh38) Human (GRCh38)
Location 2:64200646-64200668 2:64200665-64200687
Sequence CCATCTCGGCTCACTGCAACCTC CCTCTGTGTCCCAAGTTCAAGGG
Strand - +
Off-target summary {0: 5389, 1: 15264, 2: 13604, 3: 7978, 4: 5333} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!