ID: 931815516_931815518

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 931815516 931815518
Species Human (GRCh38) Human (GRCh38)
Location 2:65896890-65896912 2:65896920-65896942
Sequence CCTTTTCTCTGCTGTATCCTCAG AGCAGAACCTGATGCACAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 16, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!