ID: 931815519_931815520

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 931815519 931815520
Species Human (GRCh38) Human (GRCh38)
Location 2:65896927-65896949 2:65896940-65896962
Sequence CCTGATGCACAGCAGGTGCTCAA AGGTGCTCAAAAATGTTAACTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 53, 3: 309, 4: 1434} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!