ID: 931920499_931920512

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 931920499 931920512
Species Human (GRCh38) Human (GRCh38)
Location 2:67009909-67009931 2:67009962-67009984
Sequence CCTCCCTCAACACATGGGGATTG ATTTGAGATGAGATTTGGATGGG
Strand - +
Off-target summary {0: 7, 1: 197, 2: 979, 3: 3753, 4: 6735} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!