ID: 931920505_931920513

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 931920505 931920513
Species Human (GRCh38) Human (GRCh38)
Location 2:67009937-67009959 2:67009963-67009985
Sequence CCCTCCCTTGACCGTAGGGATTA TTTGAGATGAGATTTGGATGGGG
Strand - +
Off-target summary No data {0: 67, 1: 811, 2: 2695, 3: 11320, 4: 13537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!