ID: 932136652_932136658

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 932136652 932136658
Species Human (GRCh38) Human (GRCh38)
Location 2:69236963-69236985 2:69237012-69237034
Sequence CCCTTCTCCCTTCCTTTTTTTGT CTGTGTAATCAGATGGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 76, 3: 1110, 4: 8883} {0: 1, 1: 0, 2: 3, 3: 38, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!