ID: 932313849_932313856

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 932313849 932313856
Species Human (GRCh38) Human (GRCh38)
Location 2:70767187-70767209 2:70767211-70767233
Sequence CCGGCTGCAGAAAGGGAGGGGAG CAGGGAGAGGAGAGGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 469} {0: 1, 1: 1, 2: 29, 3: 403, 4: 3100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!