|
Left Crispr |
Right Crispr |
| Crispr ID |
932414436 |
932414441 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:71565121-71565143
|
2:71565162-71565184
|
| Sequence |
CCCAGGCTGGAGTGTAGTGGTGT |
CCTCCGCCTCACAAGTTCAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 877, 1: 25252, 2: 107026, 3: 199119, 4: 215768} |
{0: 1, 1: 24, 2: 562, 3: 1937, 4: 3223} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|