ID: 932414438_932414441

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 932414438 932414441
Species Human (GRCh38) Human (GRCh38)
Location 2:71565149-71565171 2:71565162-71565184
Sequence CCACTCACTGCAGCCTCCGCCTC CCTCCGCCTCACAAGTTCAAGGG
Strand - +
Off-target summary {0: 66, 1: 1270, 2: 5263, 3: 5630, 4: 3505} {0: 1, 1: 24, 2: 562, 3: 1937, 4: 3223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!