ID: 932439271_932439278

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 932439271 932439278
Species Human (GRCh38) Human (GRCh38)
Location 2:71721552-71721574 2:71721571-71721593
Sequence CCTTCTCTTTCCCTCAGGGAACC AACCCAAGGTCAGGGAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 389} {0: 1, 1: 0, 2: 3, 3: 31, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!