ID: 932658755_932658761

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 932658755 932658761
Species Human (GRCh38) Human (GRCh38)
Location 2:73633880-73633902 2:73633912-73633934
Sequence CCCTCCACCTTCCTGGTTCAAGT GCCTCAGTCTCCCGAGTAGCTGG
Strand - +
Off-target summary No data {0: 2967, 1: 106420, 2: 268158, 3: 215749, 4: 131204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!