ID: 932780442_932780456

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 932780442 932780456
Species Human (GRCh38) Human (GRCh38)
Location 2:74555624-74555646 2:74555677-74555699
Sequence CCCTGGAGATGCTGGAGAACTCC CTCAGAAGCCCGGGCAGGGATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 20, 4: 193} {0: 1, 1: 0, 2: 2, 3: 35, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!