ID: 932780443_932780453

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 932780443 932780453
Species Human (GRCh38) Human (GRCh38)
Location 2:74555625-74555647 2:74555672-74555694
Sequence CCTGGAGATGCTGGAGAACTCCT GACGCCTCAGAAGCCCGGGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 25, 4: 200} {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!