ID: 932780446_932780459

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 932780446 932780459
Species Human (GRCh38) Human (GRCh38)
Location 2:74555645-74555667 2:74555687-74555709
Sequence CCTTGTACAGCCCTACCTGGGAA CGGGCAGGGATGGAGTGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118} {0: 1, 1: 0, 2: 4, 3: 61, 4: 686}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!