ID: 932801163_932801169

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 932801163 932801169
Species Human (GRCh38) Human (GRCh38)
Location 2:74743610-74743632 2:74743657-74743679
Sequence CCTGTGTATGTCTCTCTGTGTGC GGTCCTTGTGTCATTTTTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 107, 4: 768} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!