ID: 932818202_932818212

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 932818202 932818212
Species Human (GRCh38) Human (GRCh38)
Location 2:74878517-74878539 2:74878543-74878565
Sequence CCTTCCTCCTCCTCCTGCCCCTG AGGTGGACTAAGCAATGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 110, 3: 1049, 4: 5067} {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!