ID: 932837310_932837322

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 932837310 932837322
Species Human (GRCh38) Human (GRCh38)
Location 2:75049653-75049675 2:75049705-75049727
Sequence CCAGCCCCTCATAGTCGCCGGCG CTTGAAGCCCAGACGGAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43} {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!