ID: 933204396_933204402

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 933204396 933204402
Species Human (GRCh38) Human (GRCh38)
Location 2:79488796-79488818 2:79488820-79488842
Sequence CCCTCCTCAGAAAGCCTCTCCTG CTGTCCTTTCACTAGATTTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 66, 4: 469} {0: 1, 1: 0, 2: 1, 3: 14, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!