ID: 933328464_933328472

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 933328464 933328472
Species Human (GRCh38) Human (GRCh38)
Location 2:80868139-80868161 2:80868168-80868190
Sequence CCCTATGCCCATTATAGTTGAGG TGGGTAAGTAGGTAGACCCACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!