ID: 933444378_933444380

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 933444378 933444380
Species Human (GRCh38) Human (GRCh38)
Location 2:82359862-82359884 2:82359914-82359936
Sequence CCACATATAAGTGAGATCCTGCA CACATAGCATAATGTCCTCAAGG
Strand - +
Off-target summary No data {0: 12, 1: 278, 2: 1240, 3: 2941, 4: 4309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!