ID: 933455056_933455061

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 933455056 933455061
Species Human (GRCh38) Human (GRCh38)
Location 2:82509005-82509027 2:82509033-82509055
Sequence CCCAAGCAAACTTGTGCAAAAGT TGGCCACAGAGGTTTCCAGCTGG
Strand - +
Off-target summary No data {0: 52, 1: 87, 2: 160, 3: 214, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!