ID: 933700937_933700939

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 933700937 933700939
Species Human (GRCh38) Human (GRCh38)
Location 2:85255155-85255177 2:85255171-85255193
Sequence CCACGACACACCTCTTGACCCAG GACCCAGACTGCATCTTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 124} {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!