ID: 933700942_933700952

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 933700942 933700952
Species Human (GRCh38) Human (GRCh38)
Location 2:85255196-85255218 2:85255246-85255268
Sequence CCTCAGCTAATGCATGCGATTGT CAGGGTGCATGAGCATCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68} {0: 1, 1: 0, 2: 10, 3: 86, 4: 580}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!