ID: 933956277_933956281

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 933956277 933956281
Species Human (GRCh38) Human (GRCh38)
Location 2:87375337-87375359 2:87375351-87375373
Sequence CCTGGACTTCACCTCGGCCAGCG CGGCCAGCGAAGGAGAGAGAGGG
Strand - +
Off-target summary No data {0: 10, 1: 9, 2: 7, 3: 28, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!