ID: 934085302_934085311

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 934085302 934085311
Species Human (GRCh38) Human (GRCh38)
Location 2:88504378-88504400 2:88504407-88504429
Sequence CCAAGAAGCTACCGATTCCGGAC ACACTTGGAGAGGCCAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 39, 3: 940, 4: 1038} {0: 8, 1: 342, 2: 8512, 3: 81777, 4: 201895}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!