ID: 934085302_934085314

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 934085302 934085314
Species Human (GRCh38) Human (GRCh38)
Location 2:88504378-88504400 2:88504426-88504448
Sequence CCAAGAAGCTACCGATTCCGGAC CAGGAGGATTGCTTGAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 39, 3: 940, 4: 1038} {0: 4337, 1: 17379, 2: 75904, 3: 175005, 4: 294037}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!