ID: 934272759_934272763

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 934272759 934272763
Species Human (GRCh38) Human (GRCh38)
Location 2:91549372-91549394 2:91549386-91549408
Sequence CCCTCTCTCTCCTTCGCTGGCCG CGCTGGCCGAGGTGAAGTCCAGG
Strand - +
Off-target summary No data {0: 5, 1: 12, 2: 5, 3: 16, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!