ID: 934575967_934575980

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 934575967 934575980
Species Human (GRCh38) Human (GRCh38)
Location 2:95401864-95401886 2:95401912-95401934
Sequence CCACCCACCCAGACACCTTTCCT CTCAAATAGAAGTCGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 3, 3: 82, 4: 785} {0: 1, 1: 2, 2: 0, 3: 2, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!