ID: 934575975_934575980

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 934575975 934575980
Species Human (GRCh38) Human (GRCh38)
Location 2:95401879-95401901 2:95401912-95401934
Sequence CCTTTCCTCAGACGGGTGGCCAG CTCAAATAGAAGTCGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 93} {0: 1, 1: 2, 2: 0, 3: 2, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!