ID: 934615343_934615351

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 934615343 934615351
Species Human (GRCh38) Human (GRCh38)
Location 2:95767259-95767281 2:95767307-95767329
Sequence CCTTCTTACAGATGAGGCACTGA TCAAGATCATAGGGCCTTTGAGG
Strand - +
Off-target summary {0: 3, 1: 4, 2: 44, 3: 278, 4: 1247} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!