ID: 934623218_934623226

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 934623218 934623226
Species Human (GRCh38) Human (GRCh38)
Location 2:95829068-95829090 2:95829106-95829128
Sequence CCCCTGGAGGCTCTGTCCAGGGA CTGGCTCGACAGCTCTGGCAGGG
Strand - +
Off-target summary {0: 21, 1: 37, 2: 41, 3: 97, 4: 483} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!